LOC100330048

Ensembl ID:
ENSDARG00000075352
Human Orthologue:
FAM5C
Human Description:
family with sequence similarity 5, member C [Source:HGNC Symbol;Acc:22393]
Mouse Orthologue:
Fam5c
Mouse Description:
family with sequence similarity 5, member C Gene [Source:MGI Symbol;Acc:MGI:2443035]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39765 Nonsense Mutation detected in F1 DNA During 2017
sa25756 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38311 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112227 Nonsense 238 768 4 7
Genomic Location (Zv9):
Chromosome 2 (position 6494362)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6877967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAACCTCGACTCTGTCAGCTCTGTTCTGGTACACAGCCACGAGAAC[A/T]AAGTTCAGTTGCAAGGTAAAAAAAAAAAAAAAAAAAAAACCCTCATCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112227 Essential Splice Site 322 768 6 7
Genomic Location (Zv9):
Chromosome 2 (position 6500262)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6883867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGAAAATCTTCGCAAAAACACTGCTAATTCAGATCTCCCTTTTCATCA[G/A]ATGAGTTCCAGAGTTTCATGGGTAAACTACCAACACAGAGCGCTCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112227 Nonsense 526 768 7 7
Genomic Location (Zv9):
Chromosome 2 (position 6509164)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6892769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACAACACATGCAATTTTTGTCAGCAACGATGTGCGCCTCAACGTTT[G/A]GTTTGACCCATCCTGGAGAAAAAGGATGCTACTAACACTAAAAAGCAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link