si:ch73-138n13.1

Ensembl ID:
ENSDARG00000075349
ZFIN ID:
ZDB-GENE-091204-448
Human Orthologue:
KIAA1671
Human Description:
KIAA1671 [Source:HGNC Symbol;Acc:29345]
Mouse Orthologue:
2900026A02Rik
Mouse Description:
RIKEN cDNA 2900026A02 gene Gene [Source:MGI Symbol;Acc:MGI:1920194]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21360 Nonsense Available for shipment Available now
sa21359 Nonsense Available for shipment Available now
sa12854 Nonsense Available for shipment Available now
sa14470 Nonsense Available for shipment Available now
sa41276 Nonsense Mutation detected in F1 DNA During 2017
sa13366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111894 Nonsense 40 1823 1 11
ENSDART00000132229 Nonsense 40 302 3 6
ENSDART00000137258   None 36 None 3
Genomic Location (Zv9):
Chromosome 8 (position 44736008)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42688790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCATAGACTCTAGCACCACGAGCTTAATGGAGAGTTCAGGTGCCCCC[C/T]AGGGGCCACTTATTAATGTCTCGGAGCCTAGCAAACCTGTCCTGGGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111894 Nonsense 361 1823 1 11
ENSDART00000132229   None 302 None 6
ENSDART00000137258   None 36 None 3
Genomic Location (Zv9):
Chromosome 8 (position 44735044)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42687826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAGGATACAGGAGGTAGCATTATAAAGAGACGCATCAGCCTGCTCT[T/A]GGACTCTTCTTCCTCATCCTTCTCAACTGTGCGTGTAGATATGTCAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111894 Nonsense 711 1823 3 11
ENSDART00000132229   None 302 None 6
ENSDART00000137258   None 36 None 3
Genomic Location (Zv9):
Chromosome 8 (position 44731398)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42684180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAGAAAGGAAGAAATGGTCAGAAGCACAAAGAGACATKGAAAGGGAA[C/T]GAGAGGAAGTTGCAGCACCCAAAAGGCCTAAGATGCTAGATGCAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111894 Nonsense 914 1823 3 11
ENSDART00000132229   None 302 None 6
ENSDART00000137258   None 36 None 3
Genomic Location (Zv9):
Chromosome 8 (position 44730789)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42683571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAGACAGAGAGAGCAAGAGAGGGAGAGACAGAGACAGATAGAGAGA[C/T]AAAGAGAAATTGAACGYCAGAAACTGAAGCAAATWGAATATGAGCGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111894 Nonsense 1455 1823 3 11
ENSDART00000132229   None 302 None 6
ENSDART00000137258   None 36 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44729165)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42681947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCAGCACCTATACTGGCTCCAGAGAGATGCTGGACCTCAGTACCTT[T/G]AAATGTAGGGTCAATTGGAGATTCAGTTTCTTCTCCCCCAACACCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111894 Nonsense 1471 1823 3 11
ENSDART00000132229   None 302 None 6
ENSDART00000137258   None 36 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44729117)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42681899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTRAATGTAGGGTCAATTGGAGATTCAGTTTCTTCTCCCCCAACACCAT[T/A]ATCTAGAAAAGAAACTTCAAGACCCAGAAGTCAAGCCTCAGCCCTGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link