csf1a

Ensembl ID:
ENSDARG00000075343
ZFIN ID:
ZDB-GENE-080204-107
Description:
macrophage colony-stimulating factor 1 [Source:RefSeq peptide;Acc:NP_001107952]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10048 Nonsense Available for shipment Available now
sa11338 Nonsense Available for shipment Available now
sa21898 Nonsense Available for shipment Available now
sa21899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 142 526 5 7
Genomic Location (Zv9):
Chromosome 11 (position 24226998)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23039595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCAACAGGACAGTCCAACGAAGTTCGTAAAAATCCACGTGACTGTGCCC[A/T]GWGCAGCTTTGGAGAAAGCTRAGGAAGTGATTCGCATGTATATGAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 265 526 6 7
Genomic Location (Zv9):
Chromosome 11 (position 24228692)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23041289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTTTGTTTCAGTAACARCACAAGGAGATTCATCCAGCTTCTTCTTT[G/T]GAAGTACTCCAAGCTTAMCAGAAGAAAACACAGAGTTGGACCTAATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 414 526 6 7
Genomic Location (Zv9):
Chromosome 11 (position 24229139)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23041736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAAAGAAGCGGCACATTCATCAGACAGTCTGACCTCTCTTGAAGAA[C/T]AGCGTGGTCATCTAAACACCCCTCCTGAAACTTTCCAAGCATACACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 453 526 7 7
Genomic Location (Zv9):
Chromosome 11 (position 24230682)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23043279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCAATTTTGATAATTGATTAAAGATGCCATTGATTTCCACAGACCAC[A/T]GATCCCTGGAGATAAAGGACCAGACTGACCCAGACGGAGATGTACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link