csf1a

Ensembl ID:
ENSDARG00000075343
ZFIN ID:
ZDB-GENE-080204-107
Description:
macrophage colony-stimulating factor 1 [Source:RefSeq peptide;Acc:NP_001107952]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10048 Nonsense Available for shipment Available now
sa11338 Nonsense Available for shipment Available now
sa21898 Nonsense Mutation detected in F1 DNA During 2014
sa21899 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 142 526 5 7
Genomic Location:
Chromosome 11 (position 24226998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCAACAGGACAGTCCAACGAAGTTCGTAAAAATCCACGTGACTGTGCCC[A/T]GWGCAGCTTTGGAGAAAGCTRAGGAAGTGATTCGCATGTATATGAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 265 526 6 7
Genomic Location:
Chromosome 11 (position 24228692)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTTTGTTTCAGTAACARCACAAGGAGATTCATCCAGCTTCTTCTTT[G/T]GAAGTACTCCAAGCTTAMCAGAAGAAAACACAGAGTTGGACCTAATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 414 526 6 7
Genomic Location:
Chromosome 11 (position 24229139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAAAGAAGCGGCACATTCATCAGACAGTCTGACCTCTCTTGAAGAA[C/T]AGCGTGGTCATCTAAACACCCCTCCTGAAACTTTCCAAGCATACACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110152 Nonsense 453 526 7 7
Genomic Location:
Chromosome 11 (position 24230682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCAATTTTGATAATTGATTAAAGATGCCATTGATTTCCACAGACCAC[A/T]GATCCCTGGAGATAAAGGACCAGACTGACCCAGACGGAGATGTACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/unprri33