si:ch73-210n19.1

Ensembl ID:
ENSDARG00000075340
ZFIN ID:
ZDB-GENE-081104-257
Description:
Novel protein similar to H.sapiens MED1, mediator complex subunit 1 (MED1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
MED1
Human Description:
mediator complex subunit 1 [Source:HGNC Symbol;Acc:9234]
Mouse Orthologue:
Med1
Mouse Description:
mediator complex subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1100846]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41990 Nonsense Mutation detected in F1 DNA During 2017
sa15854 Essential Splice Site, Missense Available for shipment Available now
sa31866 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372   None 1377 None 15
ENSDART00000123701   None 1366 None 17
ENSDART00000145656 Nonsense 305 318 6 6
Genomic Location (Zv9):
Chromosome 12 (position 16155163)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15266128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACATGGGACGTACTGGTCAAGGAAGCTCGTGCATTGATACCATGGGA[C/T]AGGTTGGAGGTCAGCAGCAAGCAATGCAGCAGCAACATCAACAATCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 Missense 581 1377 12 15
ENSDART00000123701 Essential Splice Site 584 1366 None 17
ENSDART00000145656   None 318 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16155950)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15266915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGATATTAATGAYATTCTTTCTGATAYTCCTGATCAAGCCAACAAAG[G/A]AAGCAATATCGGTCATGGACAGCATCTTATGAYTAGTGAAGATGGAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111372 Nonsense 1167 1377 14 15
ENSDART00000123701 Nonsense 1156 1366 16 17
ENSDART00000145656   None 318 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16157830)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15268795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACATCCTCAAAGCATTCTATGTCCTCCCAAGGAGGTGAGTTTTTGAGC[A/T]AACGAGACAAGATAGACAAAGATGGGAAATCCAAGATGTCTGGATCAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link