NP_001077347.1

Ensembl ID:
ENSDARG00000075335
Description:
hypothetical protein LOC100003983 [Source:RefSeq peptide;Acc:NP_001077347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31300 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108911 Nonsense 221 244 3 5
Genomic Location (Zv9):
Chromosome 2 (position 51906695)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51777065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCTGCTGGAGAACAAATCCTTCCTCTTCAACTCACTGTAACCACAT[C/A]AGAATCAGGTAAAAAAAATTCAGTGATTCTTTGTGGTAGTTAAGATGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link