si:ch211-119d14.3

Ensembl ID:
ENSDARG00000075332
ZFIN ID:
ZDB-GENE-081104-100
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UX72]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34483 Nonsense Mutation detected in F1 DNA During 2017
sa31677 Nonsense Mutation detected in F1 DNA During 2017
sa41291 Nonsense Mutation detected in F1 DNA During 2017
sa18257 Essential Splice Site Available for shipment Available now
sa21372 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110940 Nonsense 324 1025 3 11
ENSDART00000135138   None 169 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48178521)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46016779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATGTGCAAGTCTTTGGCGGATCAAGTCTCGCTCAAGGAAGACGTTT[T/A]AACAGAAATGGTGAGAGGAAAATGGTTCAGCAACAAAAAGAAAAGGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110940 Nonsense 447 1025 3 11
ENSDART00000135138   None 169 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48178151)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46016409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATCCCACTTTCAGAAGAGGACAGCGTCTCGGAAAACAATCATGTGTA[T/A]CCACCGAGAGGTCTGGGATTGGAGTATATGGTGAATTACATTCTTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110940 Nonsense 562 1025 4 11
ENSDART00000135138   None 169 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48177730)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46015988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGACCGTCTGCATAACTTCAATGATCACGTCATCCTTGACTTTCCTT[T/A]ATGCATAACCTTAAGGCATCTTCTACAGGTAATAATAATAATATTCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110940 Essential Splice Site 639 1025 5 11
ENSDART00000135138   None 169 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48174616)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46012874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGTGGTGATCATGGGTTTTCACAAACACAGCGMTTCTCTGTTATCAG[G/A]TATKGCAGCTGTAAAGCAGTTCATTTGCTAGTTTGCTTCACAGAAAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110940 Nonsense 699 1025 7 11
ENSDART00000135138   None 169 None 3
Genomic Location (Zv9):
Chromosome 8 (position 48172635)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46010893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTACCACCAAATTATCACTTTTGGGCTCCTTGGATAGGTAAAAAAACA[C/T]GACATTCAGACACGGTGTTAAACACAGAATTTGAGAAAGTTTGTCCCTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link