GOLGA4

Ensembl ID:
ENSDARG00000075331
Description:
golgin A4 [Source:HGNC Symbol;Acc:4427]
Human Orthologue:
GOLGA4
Human Description:
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologue:
Golga4
Mouse Description:
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13806 Essential Splice Site Available for shipment Available now
sa24947 Nonsense Mutation detected in F1 DNA During 2014
sa10793 Nonsense Available for shipment Available now
sa14408 Nonsense Available for shipment Available now
sa22381 Nonsense Mutation detected in F1 DNA During 2014
sa15392 Nonsense Available for shipment Available now
sa13611 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Essential Splice Site 355 2037 9 18
Genomic Location:
Chromosome 13 (position 49099762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACAGCAGCAGCTGCAGGAGAGACTGCAGGAGCTGGAGAAGATGAAGG[T/C]ACACAAACATCAACYATYACAAKACATGGAGAACAGTGCTGTRGAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Nonsense 791 2037 15 18
Genomic Location:
Chromosome 13 (position 49079040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGAAAAGTCTTTGCTGGAAGATGGAAGTGCGCAATTGGAGGAACTTT[G/A]GCTCAGGGCACAGTTAAATAAAGAGGCACTTGAGGAATCAAGATCACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Nonsense 878 2037 15 18
Genomic Location:
Chromosome 13 (position 49078779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGATCTATCTGAGAAAGAGAATTTGCATGCTGCAACTTGTAAAACAT[T/A]GCAAGAGGAGCAAAACCGGTTGAGGAAGCAGCTAGATGACCAGAAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Nonsense 1427 2037 15 18
Genomic Location:
Chromosome 13 (position 49077133)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAGATAAACTTGCAGACATGGAGAGGCAAATTGCWGAGAAGGATGRA[C/T]AGCTTCAGAYGCTCACTGCCAGCGTTGACAATCACTCCATTAGTAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Nonsense 1735 2037 15 18
Genomic Location:
Chromosome 13 (position 49076209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCAACTACCAAAATGAGGTGAGTCGCCTTAAAGAAGATCTGATTGAA[C/T]AGACATCTAGAGTGCAAGAGCTTCAACAGACATGCTCTGATCTTCGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Nonsense 1757 2037 15 18
Genomic Location:
Chromosome 13 (position 49076143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARAGCTTCAACAGACATGCTCTGAKCTTSGAGAACAGATTAAGCAGAAA[C/T]AGATTGATGAARTTGAGAGGGAACAGGTTTGTGARGTGCAAATAAACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109469 Nonsense 1963 2037 17 18
Genomic Location:
Chromosome 13 (position 49071758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACGCAGAGAAAGCTCAGTGTGTTGAAACGGAGCTTATAGAAAGCCAT[C/T]GAGATGAAGTCAGTCAGCTTCAGAAAATAATCTCTCAGAAGGAAGAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5l00nvw7