LOC572386

Ensembl ID:
ENSDARG00000075327
Human Orthologue:
DOCK10
Human Description:
dedicator of cytokinesis 10 [Source:HGNC Symbol;Acc:23479]
Mouse Orthologue:
Dock10
Mouse Description:
dedicator of cytokinesis 10 Gene [Source:MGI Symbol;Acc:MGI:2146320]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7751 Nonsense Mutation detected in F1 DNA During 2014
sa22573 Nonsense Mutation detected in F1 DNA During 2014
sa10579 Essential Splice Site Available for shipment Available now
sa15724 Essential Splice Site Available for shipment Available now
sa22572 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11003 Nonsense Available for shipment Available now
sa11297 Essential Splice Site Available for shipment Available now
sa1133 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa7751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 520 1969 18 58
Genomic Location:
Chromosome 15 (position 1956466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACTTGRCRAATAAAGCTGATTCTGACTCNCATTATGCCTCTCAGATTG[T/A]GTGACSTCCTCATATGTTGCCCTGAAGCCGTTTGAGGACTGCAGCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 636 1969 21 58
Genomic Location:
Chromosome 15 (position 1952269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAGCTATCTGTTCATTAATGTTTGTTGTGCTCTGTTTGATCAGGTC[A/T]AGATTGAGTTGCCCACACATCTTCATGAGAAACACCATATACTCTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 676 1969 21 58
Genomic Location:
Chromosome 15 (position 1952147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAATGCCAAGRCCAGCTCTAAGAAGAAAGAGGCTCTTGAATTGCCAGG[T/C]ATCRCCCGTTCAGCACAAAACCTGTSTTCYGCATATGTAAATTGAACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 745 1969 24 58
ENSDART00000112946 Essential Splice Site 745 1969 24 58
Genomic Location:
Chromosome 15 (position 1948374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATCTTCAAATTGTCCACTTTGGTGCTTTCTACAGTKTATACTCAGG[T/G]TTGGAGAAAAGANCACAATTTCAGATAAATATTATATTGTTACGCTGCARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 745 1969 24 58
ENSDART00000112946 Essential Splice Site 745 1969 24 58
Genomic Location:
Chromosome 15 (position 1948374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTTCAAATTGTCCACTTTGGTGCTTTCTACAGTGTATACTCAGG[T/C]TTGGAGAAAAGACACAATTTCAGATAAATATTATATTGTTACGCTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 776 1969 25 58
Genomic Location:
Chromosome 15 (position 1946446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGGCRGAAATCTCTCAACCTCCTACCTCAAACTTCCTCAACTGCCTT[A/T]AAGTAAGTGTACTGACCAAATCMGTGAGGTCTGGATKGTYTTTTTGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 1112 1969 35 58
Genomic Location:
Chromosome 15 (position 1933887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTTTCCTCAGAGAWCTGTTTCCAAKCTGCCTGACRGCGAGTGACCAG[G/A]TACACACACTTTAAACTATACTGTAGCCAGGTATGAGCTTTCKGACGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1133
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 1637 1969 52 58
Genomic Location:
Chromosome 15 (position 1904106)
KASP Assay ID:
554-1044.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCTCTGTAGGACACGCTGGTGGAGCAGCTGGAGATGTGTGTTGATTA[T/G]CTCTGGAAGTCTGAGAGATATGAACTTATTGCCGAGATCAACAAACCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/509gq3xw