LOC572386

Ensembl ID:
ENSDARG00000075327
Human Orthologue:
DOCK10
Human Description:
dedicator of cytokinesis 10 [Source:HGNC Symbol;Acc:23479]
Mouse Orthologue:
Dock10
Mouse Description:
dedicator of cytokinesis 10 Gene [Source:MGI Symbol;Acc:MGI:2146320]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30681 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28389 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22573 Nonsense Mutation detected in F1 DNA During 2016
sa10579 Essential Splice Site Available for shipment Available now
sa15724 Essential Splice Site Available for shipment Available now
sa22572 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11003 Nonsense Available for shipment Available now
sa28388 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11297 Essential Splice Site Available for shipment Available now
sa1133 Nonsense F2 line generated During 2016
sa35788 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 22 1969 1 58
Genomic Location (Zv9):
Chromosome 15 (position 1975118)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2022240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCCAGAGGGAGCTGATGAACATGCTGAATGTCTGCTGGTCAGACAG[G/A]TAAGTGCATGTGTGCGTGCGTGTGTGCGCATGTGTGTGTGTGTCAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 167 1969 6 58
Genomic Location (Zv9):
Chromosome 15 (position 1966745)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2013867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGAACTACCCCTTTAATGGCTAATAATTCTTGTTGGTGTGCGTAAC[A/T]GAATAATCGACTGAGGAAACATGCGTTTGAGCTGAAAATGAACGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 636 1969 21 58
Genomic Location (Zv9):
Chromosome 15 (position 1952269)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1999391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAGCTATCTGTTCATTAATGTTTGTTGTGCTCTGTTTGATCAGGTC[A/T]AGATTGAGTTGCCCACACATCTTCATGAGAAACACCATATACTCTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 676 1969 21 58
Genomic Location (Zv9):
Chromosome 15 (position 1952147)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1999269
KASP Assay ID:
2260-8048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAATGCCAAGRCCAGCTCTAAGAAGAAAGAGGCTCTTGAATTGCCAGG[T/C]ATCRCCCGTTCAGCACAAAACCTGTSTTCYGCATATGTAAATTGAACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 745 1969 24 58
ENSDART00000112946 Essential Splice Site 745 1969 24 58
Genomic Location (Zv9):
Chromosome 15 (position 1948374)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1995496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATCTTCAAATTGTCCACTTTGGTGCTTTCTACAGTKTATACTCAGG[T/G]TTGGAGAAAAGANCACAATTTCAGATAAATATTATATTGTTACGCTGCARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 745 1969 24 58
ENSDART00000112946 Essential Splice Site 745 1969 24 58
Genomic Location (Zv9):
Chromosome 15 (position 1948374)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1995496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATCTTCAAATTGTCCACTTTGGTGCTTTCTACAGTGTATACTCAGG[T/C]TTGGAGAAAAGACACAATTTCAGATAAATATTATATTGTTACGCTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 776 1969 25 58
Genomic Location (Zv9):
Chromosome 15 (position 1946446)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1993568
KASP Assay ID:
2260-8046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGGCRGAAATCTCTCAACCTCCTACCTCAAACTTCCTCAACTGCCTT[A/T]AAGTAAGTGTACTGACCAAATCMGTGAGGTCTGGATKGTYTTTTTGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 902 1969 29 58
Genomic Location (Zv9):
Chromosome 15 (position 1940569)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1987691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGTGAAGTCAATGGCTCAGCATCTGCTGGACTCAAACAAGCTCAAGG[T/A]AAATCTAGTCGCTTTGCTAAATGACTAAACTGTGAGTCTGTTCAACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 1112 1969 35 58
Genomic Location (Zv9):
Chromosome 15 (position 1933887)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1981009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTTTCCTCAGAGAWCTGTTTCCAAKCTGCCTGACRGCGAGTGACCAG[G/A]TACACACACTTTAAACTATACTGTAGCCAGGTATGAGCTTTCKGACGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1133
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Nonsense 1637 1969 52 58
Genomic Location (Zv9):
Chromosome 15 (position 1904106)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1951228
KASP Assay ID:
554-1044.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCTCTGTAGGACACGCTGGTGGAGCAGCTGGAGATGTGTGTTGATTA[T/G]CTCTGGAAGTCTGAGAGATATGAACTTATTGCCGAGATCAACAAACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112946 Essential Splice Site 1922 1969 57 58
Genomic Location (Zv9):
Chromosome 15 (position 1891516)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1938638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAGAAATACCCAGACAACCAGGTCAAACTGCTGAAAGAGATCTTCAGG[T/C]ACTGCTTCACTCACTGATCCTATCATTAATACATCCATTTTGTTTTTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link