LMF1

Ensembl ID:
ENSDARG00000075313
Description:
lipase maturation factor 1 [Source:HGNC Symbol;Acc:14154]
Human Orthologue:
LMF1
Human Description:
lipase maturation factor 1 [Source:HGNC Symbol;Acc:14154]
Mouse Orthologue:
Lmf1
Mouse Description:
lipase maturation factor 1 Gene [Source:MGI Symbol;Acc:MGI:1923733]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38865 Nonsense Mutation detected in F1 DNA During 2017
sa35176 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109523 Nonsense 160 350 5 8
Genomic Location (Zv9):
Chromosome 12 (position 1329996)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1193304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGATCCGGCGTGTGCTGAACGTGTCTCTGGGTGTCCTGATTGCATA[T/A]CTGAGCATCCCGGTGCTGATGAATCTGCTGAGCTCCAGACAGATGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109523 Essential Splice Site 255 350 6 8
Genomic Location (Zv9):
Chromosome 12 (position 1330970)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1194278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTATCACTATAGACTCGACTGGCTCATGTGGTTCGCAGCTTTCCAGG[T/A]AAAAATCACCGGCAAGTCACATTTTTAATGCATGCTCAGTCTTGTGAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link