LOC570133

Ensembl ID:
ENSDARG00000075296
Human Orthologue:
FAM83C
Human Description:
family with sequence similarity 83, member C [Source:HGNC Symbol;Acc:16121]
Mouse Orthologue:
Fam83c
Mouse Description:
family with sequence similarity 83, member C Gene [Source:MGI Symbol;Acc:MGI:1918655]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13415 Nonsense Available for shipment Available now
sa33970 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112146 Nonsense 215 584 2 4
Genomic Location (Zv9):
Chromosome 6 (position 52430648)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52479830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTTTACTGGAYGAGAAGAATCTCAGYCATTTCTTGAAYATGTGCTCA[G/T]AACTGGACGTCCAGAAYTCACACCTGAGTGTAAGTCAAACCCTGACGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112146 Essential Splice Site 266 584 4 4
Genomic Location (Zv9):
Chromosome 6 (position 52419913)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52469095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAGCTGTTTTGCAAAATATGTAACTTTCCTGTCTCTTTTCCCTTCTA[G/A]TTTTACATGGCTGTCCGGTCAGGTCCACAGCAACCTAGTAATGCACTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link