MYO15A (1 of 3)

Ensembl ID:
ENSDARG00000075292
Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Human Orthologue:
MYO15A
Human Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Mouse Orthologue:
Myo15
Mouse Description:
myosin XV Gene [Source:MGI Symbol;Acc:MGI:1261811]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13847 Essential Splice Site Available for shipment Available now
sa11241 Essential Splice Site Available for shipment Available now
sa6043 Nonsense Mutation detected in F1 DNA During 2016
sa40134 Nonsense Mutation detected in F1 DNA During 2016
sa40133 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6909 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20095 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 24 1558 2 41
Genomic Location (Zv9):
Chromosome 3 (position 40101666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39965026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTTCAATCCAACATTAAAAAGTTTTGACCTGCTTTTTCTTCCGTTTT[A/G]GCTGAGATATGAGGCCAGGAGAAAGGCAGAAGAGGAGCAGAGGAGAAWAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 41 1558 2 41
Genomic Location (Zv9):
Chromosome 3 (position 40101609)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39964969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGAGGCCAGGAGAAAGGCAGAAGAGGAGCAGAGGAGAATAGAAATGG[T/A]ATTTGTTTTCCAAATGAACCACATTGGAATACKTTTATGCTTTCCGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 71 1558 4 41
Genomic Location (Zv9):
Chromosome 3 (position 40100580)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39963940
KASP Assay ID:
554-3956.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGAGTGTAATTCNNNNNNNCTTATTCTTTCACTCTCATCTGTGTTTTAGGTGGT[C/T]GAGAGCTCCATTCTGATTGTTTGGCTTTGGTCCAGGCTCCCACAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 258 1558 7 41
Genomic Location (Zv9):
Chromosome 3 (position 40098022)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39961382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAAGCCATGCAGAAGTCCCTGTATGGACCAGAGACAGCGAGGACTTA[C/A]CCATTGTCTCTGCTGGAATGGACAGCCAATAGGAAGAAAGCAAACATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 407 1558 10 41
Genomic Location (Zv9):
Chromosome 3 (position 40088729)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39952089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATGCTCAGCTCCAGCCTCCCAGATTCAGATGGATATTACAGCCATGG[T/G]CTGCTATTGTTTTAGTTTTTACATTTTTATTTGTAATAAAAAAACTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 750 1558 20 41
Genomic Location (Zv9):
Chromosome 3 (position 40076100)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39939460
KASP Assay ID:
554-4949.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGACAGCTTCAACCACCCACTGATACTAGACCTACTGTTTAAGCAG[G/A]TTAGTTTTGGTTTTGATTCATTTTTAGCAYCATTCCTCCAGTCTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 1233 1558 34 41
Genomic Location (Zv9):
Chromosome 3 (position 40060536)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39923896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCACATTTCACCAATCTGTACATAATCATGCATAATGTGTTGTTTTTC[A/G]GGCTGGAAGGAGCTCCAAACGGCAGTTGTTTCTTCTTCCTGGTGGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 1473 1558 39 41
Genomic Location (Zv9):
Chromosome 3 (position 40056697)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39920057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGACACCCCCTGTGTACTGGCTGTCAATCAAAACGGTYTGAACTTTT[T/A]GAGCAAAGAGACTCATGTAAGTGTAATCACATTGGCTTYTRGATAAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link