MYO15A (1 of 3)

Ensembl ID:
ENSDARG00000075292
Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Human Orthologue:
MYO15A
Human Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Mouse Orthologue:
Myo15
Mouse Description:
myosin XV Gene [Source:MGI Symbol;Acc:MGI:1261811]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13847 Essential Splice Site Available for shipment Available now
sa11241 Essential Splice Site Available for shipment Available now
sa6043 Nonsense Mutation detected in F1 DNA During 2014
sa6909 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20095 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 24 1558 2 41
Genomic Location:
Chromosome 3 (position 40101666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTTCAATCCAACATTAAAAAGTTTTGACCTGCTTTTTCTTCCGTTTT[A/G]GCTGAGATATGAGGCCAGGAGAAAGGCAGAAGAGGAGCAGAGGAGAAWAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 41 1558 2 41
Genomic Location:
Chromosome 3 (position 40101609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGAGGCCAGGAGAAAGGCAGAAGAGGAGCAGAGGAGAATAGAAATGG[T/A]ATTTGTTTTCCAAATGAACCACATTGGAATACKTTTATGCTTTCCGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 71 1558 4 41
Genomic Location:
Chromosome 3 (position 40100580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGAGTGTAATTCNNNNNNNCTTATTCTTTCACTCTCATCTGTGTTTTAGGTGGT[C/T]GAGAGCTCCATTCTGATTGTTTGGCTTTGGTCCAGGCTCCCACAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 750 1558 20 41
Genomic Location:
Chromosome 3 (position 40076100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGACAGCTTCAACCACCCACTGATACTAGACCTACTGTTTAAGCAG[G/A]TTAGTTTTGGTTTTGATTCATTTTTAGCAYCATTCCTCCAGTCTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Essential Splice Site 1233 1558 34 41
Genomic Location:
Chromosome 3 (position 40060536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCACATTTCACCAATCTGTACATAATCATGCATAATGTGTTGTTTTTC[A/G]GGCTGGAAGGAGCTCCAAACGGCAGTTGTTTCTTCTTCCTGGTGGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110025 Nonsense 1473 1558 39 41
Genomic Location:
Chromosome 3 (position 40056697)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGACACCCCCTGTGTACTGGCTGTCAATCAAAACGGTYTGAACTTTT[T/A]GAGCAAAGAGACTCATGTAAGTGTAATCACATTGGCTTYTRGATAAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w5pfxnsv