CDH22

Ensembl ID:
ENSDARG00000075268
Description:
cadherin 22, type 2 [Source:HGNC Symbol;Acc:13251]
Human Orthologue:
CDH22
Human Description:
cadherin 22, type 2 [Source:HGNC Symbol;Acc:13251]
Mouse Orthologue:
Cdh22
Mouse Description:
cadherin 22 Gene [Source:MGI Symbol;Acc:MGI:1341843]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8252 Nonsense Mutation detected in F1 DNA During 2014
sa20832 Nonsense Mutation detected in F1 DNA During 2014
sa18858 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Nonsense 75 519 1 8
Genomic Location:
Chromosome 6 (position 56826951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGTTCTTCGTTGTGGAGGAATACACCGGGACGGAGCCACTTTATGTG[G/T]GAAAGGTAGGACTGCATTTTGTGGCATACAGTTAAAGTCAGAATTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Nonsense 314 519 5 8
Genomic Location:
Chromosome 6 (position 56731739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGAGAATACGGATATGAGTTACCTGATCAAAGACGAGGAGGGAGGA[G/T]AGCTGTTCAGAGTGTCCACTGATGGAGACACACAGGAGGCCGTCATCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Essential Splice Site 419 519 6 8
Genomic Location:
Chromosome 6 (position 56729490)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGAATCGTGACAGCCAGAGATCCAGATATGGACAACGTCCCCATCAG[G/A]TGTGGTTTAATACAGTTCAAGTTTATTTGTATAGACACACACTTGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uc0smfsv