CDH22

Ensembl ID:
ENSDARG00000075268
Description:
cadherin 22, type 2 [Source:HGNC Symbol;Acc:13251]
Human Orthologue:
CDH22
Human Description:
cadherin 22, type 2 [Source:HGNC Symbol;Acc:13251]
Mouse Orthologue:
Cdh22
Mouse Description:
cadherin 22 Gene [Source:MGI Symbol;Acc:MGI:1341843]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20832 Nonsense Available for shipment Available now
sa18858 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Nonsense 314 519 5 8
Genomic Location (Zv9):
Chromosome 6 (position 56731739)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 56784891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGAGAATACGGATATGAGTTACCTGATCAAAGACGAGGAGGGAGGA[G/T]AGCTGTTCAGAGTGTCCACTGATGGAGACACACAGGAGGCCGTCATCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110855 Essential Splice Site 419 519 6 8
Genomic Location (Zv9):
Chromosome 6 (position 56729490)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 56782642
KASP Assay ID:
2259-8250.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGAATCGTGACAGCCAGAGATCCAGATATGGACAACGTCCCCATCAG[G/A]TGTGGTTTAATACAGTTCAAGTTTATTTGTATAGACACACACTTGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link