LOC100151027

Ensembl ID:
ENSDARG00000075263
Human Orthologue:
ANKRD23
Human Description:
ankyrin repeat domain 23 [Source:HGNC Symbol;Acc:24470]
Mouse Orthologue:
Ankrd23
Mouse Description:
ankyrin repeat domain 23 Gene [Source:MGI Symbol;Acc:MGI:1925571]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42923 Nonsense Mutation detected in F1 DNA During 2016
sa6473 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23074 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112959 Nonsense 102 317 3 9
Genomic Location (Zv9):
Chromosome 17 (position 23295452)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23445601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATATTTTGGAACTGAGAAAGAGGAGAAAGGAAAGGAAGATTCAGATGT[T/G]AAAGAAAGAGCCAGAGCCTGATATCTTGGTGAGGTGTTCCCTTCCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112959 Essential Splice Site 246 317 7 9
Genomic Location (Zv9):
Chromosome 17 (position 23297817)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23447966
KASP Assay ID:
554-5193.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTGAGCATCTCATTCACTGTGGAGCTGATGTAAATGCYAAAGACAGG[G/T]TAAGAATKATTTTTGCAACTYCTTYCTCAAAGAATGCTGCAAARCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112959 Nonsense 313 317 9 9
Genomic Location (Zv9):
Chromosome 17 (position 23299177)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23449326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACATTCTAAATAACCTTAATGAATGTGAAGCTCCAAAGTCAGATGAA[C/T]AACTTTTCAGCATTTGATGCACTGAAGGGTTTCAGATGTTCTTTCCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link