phrf1

Ensembl ID:
ENSDARG00000075252
ZFIN IDs:
ZDB-GENE-030131-624, ZDB-GENE-030131-624
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A5PL95]
Human Orthologue:
PHRF1
Human Description:
PHD and ring finger domains 1 [Source:HGNC Symbol;Acc:24351]
Mouse Orthologue:
Phrf1
Mouse Description:
PHD and ring finger domains 1 Gene [Source:MGI Symbol;Acc:MGI:2141847]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24688 Essential Splice Site Available for shipment Available now
sa32535 Nonsense Available for shipment Available now
sa13540 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121617 Essential Splice Site 164 1669 4 17
ENSDART00000130011 Essential Splice Site 164 807 5 15
Genomic Location (Zv9):
Chromosome 25 (position 26384351)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25423833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATAACATTATCCTGAGAAAGTGCCATGGTGGGAAAATCCAAAAAACA[G/A]TGAGTCATGTAATGCATCTCTTCAGAATTGCTTTACACATGGTTTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121617 Nonsense 409 1669 10 17
ENSDART00000130011 Nonsense 409 807 11 15
Genomic Location (Zv9):
Chromosome 25 (position 26401573)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25441055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCAGAGTCTGGTTCCATCATTCCCTCTGTTTATCGGCCTTCAGAGTA[C/A]AGTTTAGGAAGTATGAGGGCAGAAATTGGAGCAGCTTCCCTTTCTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121617 Nonsense 1437 1669 13 17
ENSDART00000130011   None 807 None 15
Genomic Location (Zv9):
Chromosome 25 (position 26406287)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25445769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAGCAAGAACCTGTTATTTCTTCTGATGAAGATATCAGTGTTGATTA[C/A]TTGATCGATAATTTGGACTTTATTAAGAAAGAAATGAGTGAGACCTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link