LOC556398

Ensembl ID:
ENSDARG00000075249
Human Orthologue:
FAM171A2
Human Description:
family with sequence similarity 171, member A2 [Source:HGNC Symbol;Acc:30480]
Mouse Orthologue:
Fam171a2
Mouse Description:
family with sequence similarity 171, member A2 Gene [Source:MGI Symbol;Acc:MGI:2448496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33149 Nonsense Mutation detected in F1 DNA During 2016
sa15965 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114906 Nonsense 559 828 8 8
Genomic Location (Zv9):
Chromosome 3 (position 21496350)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21152741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTCCTCTGACTTGACAGCTGTGGAGCAGGCAATGGAACGGCAACAA[C/T]AGCTGCAGCACGATATGGAGGGCATCCAGGTTAGTATGACTCTACCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114906 Nonsense 814 828 8 8
Genomic Location (Zv9):
Chromosome 3 (position 21495583)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21151974
KASP Assay ID:
2259-3334.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACRATAATGATGACAAAGATGATGACGGAGAGAATAAGAAGAGCCCCTG[G/A]CAAAAGCGTGAAGAAAGACCCCTCATGGTGTTTAATGTCAAGTAATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link