PACS1 (3 of 3)

Ensembl ID:
ENSDARG00000075246
Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Human Orthologue:
PACS1
Human Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Mouse Orthologue:
Pacs1
Mouse Description:
phosphofurin acidic cluster sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277113]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24817 Nonsense Available for shipment Available now
sa39515 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065424 Nonsense 376 552 13 18
Genomic Location (Zv9):
Chromosome Zv9_NA398 (position 14805)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150122.1 14805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCAACACTCCTGTGAAAGATCGGCAACTCTCCAAACCTCTGAATGAA[C/T]GAACCAACAGCTCGGACAGCGAAAGATCTCCTGAACTCGGACACAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065424 Nonsense 487 552 17 18
Genomic Location (Zv9):
Chromosome Zv9_NA398 (position 8465)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150122.1 8465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCGATGCCGCGGCCGGTGAAGGTGGCAGTGGTCGGGGGTCAGAGTTA[T/A]CTGGGGTCAGTGCTGCAGTTCTTCGTCACTCAACTCGCCAATAAAACCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link