LOC100329986

Ensembl ID:
ENSDARG00000075239
Human Orthologue:
SPAG16
Human Description:
sperm associated antigen 16 [Source:HGNC Symbol;Acc:23225]
Mouse Orthologue:
Spag16
Mouse Description:
sperm associated antigen 16 Gene [Source:MGI Symbol;Acc:MGI:1913972]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39498 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115055 Nonsense 428 619 1 1
Genomic Location (Zv9):
Chromosome Zv9_scaffold3460 (position 681)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40655711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCAAAGTCGATGTGTGCTCAGTTTGGAGGGGCACCTTCACGCCACTT[G/A]GGCCTGTTCTTTTCACTCCTGTGGTGATTTTGTGGCATCTTGCTCCATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link