GRM5 (2 of 2)

Ensembl ID:
ENSDARG00000075227
Description:
glutamate receptor, metabotropic 5 [Source:HGNC Symbol;Acc:4597]
Human Orthologue:
GRM5
Human Description:
glutamate receptor, metabotropic 5 [Source:HGNC Symbol;Acc:4597]
Mouse Orthologue:
Grm5
Mouse Description:
glutamate receptor, metabotropic 5 Gene [Source:MGI Symbol;Acc:MGI:1351342]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8439 Nonsense Mutation detected in F1 DNA During 2016
sa12152 Nonsense Available for shipment Available now
sa6398 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108898 Nonsense 159 982 2 14
Genomic Location (Zv9):
Chromosome 15 (position 42439593)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43626918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCCACTGCCGRCTGAAGGGACACGCGCARGAGAACCACAAATACAAC[C/T]GAACCTGCGGCAGTAAGTCAACATTTGTTAAGASTTTTCYATTGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108898 Nonsense 503 982 7 14
Genomic Location (Zv9):
Chromosome 15 (position 42420283)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43646228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATCGTGGCGCTTTTCGTAATGGAGCCGCCTGACGTCATCCACGATTA[T/A]CCATCAATCCGTGAGGTTAATTTAATCTGCAACACCACCAATCTAGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108898 Nonsense 675 982 11 14
Genomic Location (Zv9):
Chromosome 15 (position 42415923)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43650588
KASP Assay ID:
554-4880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTGTTTACCATATAATCTCTGTGTTCAGATGTGCTGCATAATAGATG[G/A]AGATCAAAGACCAGACGCACCATTYTGGTGTCCTTGTCAAGTAAAAACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link