si:ch211-95o16.2

Ensembl ID:
ENSDARG00000075215
ZFIN ID:
ZDB-GENE-070705-251
Description:
vezatin [Source:RefSeq peptide;Acc:NP_001108047]
Human Orthologue:
VEZT
Human Description:
vezatin, adherens junctions transmembrane protein [Source:HGNC Symbol;Acc:18258]
Mouse Orthologue:
Vezt
Mouse Description:
vezatin, adherens junctions transmembrane protein Gene [Source:MGI Symbol;Acc:MGI:2143698]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26309 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11249 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109508 Essential Splice Site 60 783 3 12
ENSDART00000134218 Essential Splice Site 60 172 3 5
ENSDART00000136927 Essential Splice Site 59 781 3 12
ENSDART00000138603 Essential Splice Site 59 138 3 4
Genomic Location (Zv9):
Chromosome 4 (position 25013595)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25937264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAAATTGAGTCTGCTGTGGTCATTCATCTGTGTGTGTTTTTGCAGAA[G/T]AGTGGTGTTTGGAGGCTGGTTGATGCTCTGCGGGGTCTCAATCCTCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109508 Nonsense 549 783 11 12
ENSDART00000134218   None 172 None 5
ENSDART00000136927 Nonsense 547 781 11 12
ENSDART00000138603   None 138 None 4
Genomic Location (Zv9):
Chromosome 4 (position 25028592)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25952261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTAGATTAAAAACTCAGCTTTTCTGTTGTCCAGGAGTTGGAGGCGTA[T/A]GTGTCGGACTCAGACTCTGATACGGAGTGGAGAGGAGGATCTGACATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link