chd7

Ensembl ID:
ENSDARG00000075211
ZFIN ID:
ZDB-GENE-070912-179
Description:
LOC569471 protein [Source:UniProtKB/TrEMBL;Acc:A7E291]
Human Orthologue:
CHD7
Human Description:
chromodomain helicase DNA binding protein 7 [Source:HGNC Symbol;Acc:20626]
Mouse Orthologue:
Chd7
Mouse Description:
chromodomain helicase DNA binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2444748]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa596 Nonsense F2 line generated During 2014
sa19733 Nonsense Available for shipment Available now
sa6835 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19732 Nonsense Mutation detected in F1 DNA During 2014
sa11593 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa596
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 40 3140 1 37
ENSDART00000114089 Nonsense 40 653 2 3
ENSDART00000121586 Nonsense 40 62 2 2
ENSDART00000135230 Nonsense 40 3140 2 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 21604318)
KASP Assay ID:
554-0506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTAGGGGACTGTGGCTACCCTCAAGGTCAGACAAATCCTATGAGTCAA[C/T]AGATGCCCCATGAGCACCAAGGCTATGGGCAGCTTCCTCCTTCTCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 377 3140 1 37
ENSDART00000114089 Nonsense 377 653 2 3
ENSDART00000121586 None None 62 None 2
ENSDART00000135230 Nonsense 377 3140 2 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 21603307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACCCTGCTCCGGCAGGGCCTCAGCGCTACCCTACACCTGGGGGTCAA[C/T]AGGGACCATTGCACCAGCAGCCCATTCATGTGAACCAAATCAATACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Essential Splice Site 859 3140 6 37
ENSDART00000114089 None None 653 None 3
ENSDART00000121586 None None 62 None 2
ENSDART00000135230 Essential Splice Site 859 3140 7 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 21581122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATGCACCCTTTTCAAACAACTAATTAATGTTTCTGCTTATTTTACA[G/A]TTGGCGTCTGGTGAAGAGATAGAAGTCGAAGAGTTTTACGTCAAATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 1449 3140 17 37
ENSDART00000114089 None None 653 None 3
ENSDART00000121586 None None 62 None 2
ENSDART00000135230 Nonsense 1449 3140 18 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 21577023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCTCAAAGGCGGTGTATGTGACCGGTTTGTGCTGTTGCCTCCAGGCA[C/T]AAGCTCGATGCCACAGGATAGGACAGAGCAAGTCTGTGAAGATTTACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016208 Nonsense 1541 3140 18 37
ENSDART00000114089 None None 653 None 3
ENSDART00000121586 None None 62 None 2
ENSDART00000135230 Nonsense 1541 3140 19 38

The following transcripts of ENSDARG00000075211 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 21576493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGGAAGAGGAGGATGAGGGATCCAAGTTCTGTGAAGAAGACATTGAT[C/T]AGATTTTGCAGAGAMGTACACAGACCAKTACAATTGAATCAGAAGGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/32v2rtq7