LOC100330335

Ensembl ID:
ENSDARG00000075206
Human Orthologue:
C8orf74
Human Description:
chromosome 8 open reading frame 74 [Source:HGNC Symbol;Acc:32296]
Mouse Orthologue:
4930578I06Rik
Mouse Description:
RIKEN cDNA 4930578I06 gene Gene [Source:MGI Symbol;Acc:MGI:1915000]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113885 Nonsense 266 279 4 4
Genomic Location:
Chromosome 17 (position 5518354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGAAGTGCAAAGRCAGCTTGCTAATAYRCCTGTTTTCCCTGAAAAA[C/T]AAACATCGATAAYGCCAACAAGATCCAAAAAGAAGGGAAATTGACGTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6x9njxyf