si:ch211-236d22.1

Ensembl ID:
ENSDARG00000075201
ZFIN ID:
ZDB-GENE-090312-97
Description:
type II inositol-3,4-bisphosphate 4-phosphatase [Source:RefSeq peptide;Acc:NP_001139046]
Human Orthologue:
INPP4B
Human Description:
inositol polyphosphate-4-phosphatase, type II, 105kDa [Source:HGNC Symbol;Acc:6075]
Mouse Orthologue:
Inpp4b
Mouse Description:
inositol polyphosphate-4-phosphatase, type II Gene [Source:MGI Symbol;Acc:MGI:2158925]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30588 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19605 Nonsense Available for shipment Available now
sa18139 Essential Splice Site Available for shipment Available now
sa31235 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108492 Essential Splice Site 464 760 10 17
ENSDART00000147683 Essential Splice Site 531 827 13 20

The following transcripts of ENSDARG00000075201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 53681751)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52551322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGGTCTGCAGCTCCAGCAGAGACGAGACACCGTTTTCAGCCAAGCT[G/A]TAAGTCTCACAGAAGAAAAACAAGATTTTCACACTGAGGGTGTTCATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108492 Nonsense 551 760 13 17
ENSDART00000147683 Nonsense 618 827 16 20

The following transcripts of ENSDARG00000075201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 53691681)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52561252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTGATGCTGTGTGGAAATGTGACCTGTTTTAATGGCAGAGACCGTTA[C/A]ACTGTGGAGGTGCCTCTGCCACATGATGCCTTCCAGACGCTGCCGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108492 Essential Splice Site 665 760 15 17
ENSDART00000147683 Essential Splice Site 732 827 18 20

The following transcripts of ENSDARG00000075201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 53697716)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52567287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGACCAAGAAGAGGAAGAACRTGGAGATATTGTGGCTTGCAGGAACGG[T/A]GAGAGTTTGAGGAGTCTGTGCAGGAANNGTGTGTGTGTGCAAGATCTTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108492 Nonsense 667 760 16 17
ENSDART00000147683 Nonsense 734 827 19 20

The following transcripts of ENSDARG00000075201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 53704252)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52573823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGAGAAAGTGTACTCAATGGTCTGTCTGTGTGTGTTGTCAGATCTG[T/A]CGACGGATGAATGGTATCCGCTTCACCAGCTGTAAAAGTGCCAAAGACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link