si:ch73-150k18.1

Ensembl ID:
ENSDARG00000075189
ZFIN ID:
ZDB-GENE-070705-209
Description:
Novel protein similar to contactin associated protein-like 5 (CNTNAP5) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
CNTNAP5
Human Description:
contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
Mouse Orthologues:
Cntnap5a, Cntnap5b, Cntnap5c
Mouse Descriptions:
contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43794 Nonsense Mutation detected in F1 DNA During 2017
sa32391 Nonsense Available for shipment Available now
sa24108 Nonsense Available for shipment Available now
sa12112 Essential Splice Site Available for shipment Available now
sa43793 Nonsense Mutation detected in F1 DNA During 2017
sa24107 Essential Splice Site Available for shipment Available now
sa37462 Nonsense Mutation detected in F1 DNA During 2017
sa39363 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Nonsense 217 1306 5 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13677486)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13509096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCACCAGCACGGTGAAAGACGTCATTTCATTGCGGTTTAAGAGCCAA[C/T]GAGCTGACGGGGTCCTTGTGCACGGAGAGGGACAAAGGGGTGATTACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Nonsense 291 1306 6 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13670421)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13501639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCGTCCTGATTGAGCGATTTAACAAACAGATCAACTTCACTGTGGAC[A/T]GACTGACCAAACACGTCAGGACGGGTGGACTGGACGATTCTCTGGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Nonsense 349 1306 7 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13668503)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13499721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCATGGAGAACCTCTACTACAACGGCGTCAACATCATCGACCTGGCC[A/T]AACGCCGCAAACCACAGATCTACAGTGTGGTGAGGATGTTCATCTCGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Essential Splice Site 588 1306 11 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13638207)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13472676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCGACTGCTCGGGAACAGGATACACYGGAGCCACCTGTCATAACTG[T/G]GAGTTGGCATGTAACCCATACAAAARAAACAACAATAACAAKATACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Nonsense 881 1306 17 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13621094)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13456589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGTGAAGTCTCACGTTCCTCTGAATGACAAGCAGTGGCATTACGTT[C/T]GATCGGAGAGGAATGTGAGGGAGGCGTCGCTGCAGGTGGACCAGCTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Essential Splice Site 1000 1306 19 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13612367)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13447884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCACGAGCGTTTGTGACAATGCTTTTTGTGTTTTTCTTCCTTTGC[A/T]GAGGTTTCCGTGTCATTTGAAAGCGGGTCCTCGGTGACCTACACCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Nonsense 1144 1306 21 24
ENSDART00000134035   None 158 None 3
Genomic Location (Zv9):
Chromosome 22 (position 13605840)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13441670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGCCTGTCGACGGACAAAGAGTTGATCACGATAAGGTCTTTGACAT[T/A]GGGGAAAGTCACAGGTAGGCGGTTTAATTAAACTCTAAGATTAAAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110136 Essential Splice Site 1216 1306 22 24
ENSDART00000134035 Essential Splice Site 68 158 1 3
Genomic Location (Zv9):
Chromosome 22 (position 13605335)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13441265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAATTGTGGAGAGCTTGCGGATAAGTCTTCATCCAGATCTTTGTCAG[G/A]TTGGTCAAACTATTATAGAGTCTTATGATTTGAATGAATTGCAGGATGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link