si:ch211-241d21.7

Ensembl ID:
ENSDARG00000075183
ZFIN ID:
ZDB-GENE-081104-195
Description:
Novel protein similar to H.sapiens C1orf164, chromosome 1 open reading frame 164 (C1orf164) [Source:
Human Orthologue:
RNF220
Human Description:
ring finger protein 220 [Source:HGNC Symbol;Acc:25552]
Mouse Orthologue:
Rnf220
Mouse Description:
ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31641 Nonsense Available for shipment Available now
sa27161 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089411 Nonsense 292 565 5 15
ENSDART00000133952   None 111 None 4
ENSDART00000134534   None 247 None 3
ENSDART00000143000   None 113 None 4
Genomic Location (Zv9):
Chromosome 8 (position 18781499)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18226387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATAAAGAGAGAAGGTTCCTCTTCTGCCTCTTCTCCACGTCCTGCTGAT[G/T]AGGCTGTGCACTCTGACAGGTACCAGGTGAGCACATGTTATATTATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089411 Essential Splice Site 367 565 8 15
ENSDART00000133952 Essential Splice Site 53 111 2 4
ENSDART00000134534   None 247 None 3
ENSDART00000143000   None 113 None 4
Genomic Location (Zv9):
Chromosome 8 (position 18778168)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18223056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAGCAGAGAAGAATACAGATGGTTTCTGTTCTCAGAGGCTTCAGAGG[T/A]ATAAAACACACAAAAACGTAATTGAACTATGAGCCAAATGTACAGACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link