si:ch1073-322p19.1

Ensembl ID:
ENSDARG00000075173
ZFIN ID:
ZDB-GENE-091204-224
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11982 Nonsense Available for shipment Available now
sa8654 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114108 Nonsense 159 533 2 3
ENSDART00000132817 Nonsense 183 557 2 3
Genomic Location (Zv9):
Chromosome 3 (position 1875275)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1333487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTTCGGCCAGGAGGCGCTACGCCACACGCTGGTGCTGTTCACACAC[G/T]GAGACGCGCTGGAGGAMGCCGGCGGGTTCGAGAGTTTCCTGGAGGACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114108 Nonsense 281 533 3 3
ENSDART00000132817 Nonsense 305 557 3 3
Genomic Location (Zv9):
Chromosome 3 (position 1878285)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1336497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCTCTGAGCCRCATCCGCATGGAAGMCGCACTCTCYGGGAAGGTTCTG[C/T]AGCGCGTCAAGGTGCTGGTCGCAGCCGGYGCTGCAGGAATGGCGGTCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link