fbxo25

Ensembl ID:
ENSDARG00000075172
ZFIN ID:
ZDB-GENE-040801-19
Description:
F-box only protein 25 [Source:RefSeq peptide;Acc:NP_991287]
Human Orthologue:
FBXO25
Human Description:
F-box protein 25 [Source:HGNC Symbol;Acc:13596]
Mouse Orthologue:
Fbxo25
Mouse Description:
F-box protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11687 Essential Splice Site Available for shipment Available now
sa37763 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113643 Essential Splice Site 157 356 6 10
ENSDART00000138660   None 150 None 6
Genomic Location (Zv9):
Chromosome 23 (position 35531389)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35380981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTCAGAAGAACTACTTTAACGTTCTGGAGAAGATTGTGAGGAAAGG[T/G]GAATGAACAGGTGTTACTCGCATACAGTTGAAATCAGAATTATTAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113643 Nonsense 231 356 8 10
ENSDART00000138660   None 150 None 6
Genomic Location (Zv9):
Chromosome 23 (position 35528288)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35377880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTGTGCAGCAAGTTTCAAACGGGATGACACTGAGCGACCTCCCTT[T/A]GCACATGCAAACCAACATCCTTTACCAGTTTACCGATGCCTATGACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link