fbxo25

Ensembl ID:
ENSDARG00000075172
ZFIN ID:
ZDB-GENE-040801-19
Description:
F-box only protein 25 [Source:RefSeq peptide;Acc:NP_991287]
Human Orthologue:
FBXO25
Human Description:
F-box protein 25 [Source:HGNC Symbol;Acc:13596]
Mouse Orthologue:
Fbxo25
Mouse Description:
F-box protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914072]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11687 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113643 Essential Splice Site 157 356 6 10
ENSDART00000138660 None None 150 None 6
Genomic Location:
Chromosome 23 (position 35531389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTCAGAAGAACTACTTTAACGTTCTGGAGAAGATTGTGAGGAAAGG[T/G]GAATGAACAGGTGTTACTCGCATACAGTTGAAATCAGAATTATTAGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qzmsdttr