LOC100000886

Ensembl ID:
ENSDARG00000075170
Human Orthologue:
ZDHHC22
Human Description:
zinc finger, DHHC-type containing 22 [Source:HGNC Symbol;Acc:20106]
Mouse Orthologue:
Zdhhc22
Mouse Description:
zinc finger, DHHC-type containing 22 Gene [Source:MGI Symbol;Acc:MGI:2685108]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14460 Nonsense Available for shipment Available now
sa1786 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110796 Nonsense 87 280 1 2
Genomic Location:
Chromosome 17 (position 44937459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATACGGAACCCATCCGAGAGTGCCAACGAGACCGTTATCCCAGTCTG[T/A]TCACCCGACTGCCCGGACAGAATTGATGCGCACTACCTCCTGAATGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110796 Nonsense 151 280 1 2
Genomic Location:
Chromosome 17 (position 44937268)
KASP Assay ID:
554-1779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTTTATTATGTTCAGCATCTATACGTCCAGCTCTTGTCTATATTCAT[T/A]GGTAATAGGGGTGGCATATCTGACAATAGAGTACTCTATTTCCTTYGAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mktn5z0d