bbs1

Ensembl ID:
ENSDARG00000075169
ZFIN ID:
ZDB-GENE-060126-1
Description:
Bardet-Biedl syndrome 1 protein [Source:RefSeq peptide;Acc:NP_001091721]
Human Orthologue:
BBS1
Human Description:
Bardet-Biedl syndrome 1 [Source:HGNC Symbol;Acc:966]
Mouse Orthologue:
Bbs1
Mouse Description:
Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16994 Essential Splice Site Available for shipment Available now
sa13530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113061 Essential Splice Site 365 588 11 17
Genomic Location:
Chromosome 21 (position 26866534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACACATGTAYAGAGACAAAAACCTTATYGGCACTATYAAGACTCCGG[T/A]AAGAACTGTCYTTGAYACATTTGGGTTTGGGTTGTGATRTGGTRAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113061 Nonsense 550 588 16 17
Genomic Location:
Chromosome 21 (position 26871327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCTGGTTCCAGGGCTAAATTACCCTATTGACACTTTTGTGGAGTGCT[T/A]RAGCGACAAAGGCGTCTCKGACATTATCAAAGTGAGACNNTTTTTTTNTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1ph7vkj0