bbs1

Ensembl ID:
ENSDARG00000075169
ZFIN ID:
ZDB-GENE-060126-1
Description:
Bardet-Biedl syndrome 1 protein [Source:RefSeq peptide;Acc:NP_001091721]
Human Orthologue:
BBS1
Human Description:
Bardet-Biedl syndrome 1 [Source:HGNC Symbol;Acc:966]
Mouse Orthologue:
Bbs1
Mouse Description:
Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29611 Essential Splice Site Mutation detected in F1 DNA During 2015
sa16994 Essential Splice Site Available for shipment Available now
sa13530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113061 Essential Splice Site 236 588 8 17
Genomic Location:
Chromosome 21 (position 26864019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGGATGTTTACATATTGGATCCAGAAGCCTTTACCATTCTCTACAAGG[T/G]CAGCTTTAAGGGAGAACATTGCATCACATTGCAATGTGAACCTAAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113061 Essential Splice Site 365 588 11 17
Genomic Location:
Chromosome 21 (position 26866534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACACATGTAYAGAGACAAAAACCTTATYGGCACTATYAAGACTCCGG[T/A]AAGAACTGTCYTTGAYACATTTGGGTTTGGGTTGTGATRTGGTRAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113061 Nonsense 550 588 16 17
Genomic Location:
Chromosome 21 (position 26871327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCTGGTTCCAGGGCTAAATTACCCTATTGACACTTTTGTGGAGTGCT[T/A]RAGCGACAAAGGCGTCTCKGACATTATCAAAGTGAGACNNTTTTTTTNTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1ph7vkj0