LOC559312

Ensembl ID:
ENSDARG00000075165
Human Orthologues:
ZC3H6, ZC3H8
Human Descriptions:
zinc finger CCCH-type containing 6 [Source:HGNC Symbol;Acc:24762]
zinc finger CCCH-type containing 8 [Source:HGNC Symbol;Acc:30941]
Mouse Orthologues:
Zc3h6, Zc3h8
Mouse Descriptions:
zinc finger CCCH type containing 6 Gene [Source:MGI Symbol;Acc:MGI:1926001]
zinc finger CCCH type containing 8 Gene [Source:MGI Symbol;Acc:MGI:1930128]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15241 Nonsense Available for shipment Available now
sa10803 Nonsense Available for shipment Available now
hu7905 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109978 Nonsense 166 1070 5 14
Genomic Location:
Chromosome 13 (position 48806570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WAGTTGGTGGGCAGCGTGGCAGAGGTCGTGGTGGTGTTRTTGGTAGAGGA[C/T]GAGGAATGCTGAACAAAAATAAGAAACTAAAGGGCAAGAACTGGGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109978 Nonsense 166 1070 5 14
Genomic Location:
Chromosome 13 (position 48806570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WAGTTGGTGGGCAGCGTGGCAGAGGTCGTGGTGGTGTTRTTGGTAGAGGA[C/T]GAGGAATGCTGAACAAAAATAAGAAACTAAAGGGCAAGAACTGGGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109978 Essential Splice Site 991 1070 14 14
Genomic Location:
Chromosome 13 (position 48816253)
KASP Assay ID:
554-2395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYGAGGACTCTGAGAGCAATGCAAGTGTGTCGATTCCTCCAGTGCCTAC[A/T]GTAATGCCGGCGTCTCCTTGTTCTCCTSTWTTGGCGGCAGCTCCAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2z5mfash