LOC100331020

Ensembl ID:
ENSDARG00000075162
Human Orthologue:
CHDH
Human Description:
choline dehydrogenase [Source:HGNC Symbol;Acc:24288]
Mouse Orthologue:
Chdh
Mouse Description:
choline dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1860776]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25412 Nonsense Mutation detected in F1 DNA During 2014
sa21400 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111007 Nonsense 116 585 2 8
Genomic Location:
Chromosome 8 (position 55543703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTACCACACGTTACCTCAGGCCCACATGGATGACCGTGTGATGTACT[G/A]GCCCCGCGGGCGTGTCTGGGGCGGCTCATCCTCACTTAACGCCATGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111007 Nonsense 209 585 2 8
Genomic Location:
Chromosome 8 (position 55543981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTATGCATTCATCCAGGCGGGACAGCAGGCTGGATACCCCTACACC[G/T]AGGACATGAACGGGTTCCAGCAGGAGGGGGTCGGCTGGATGGACATGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gc9d1v6q