LOC100331020

Ensembl ID:
ENSDARG00000075162
Human Orthologue:
CHDH
Human Description:
choline dehydrogenase [Source:HGNC Symbol;Acc:24288]
Mouse Orthologue:
Chdh
Mouse Description:
choline dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1860776]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25412 Nonsense Mutation detected in F1 DNA During 2016
sa21400 Nonsense Mutation detected in F1 DNA During 2016
sa41313 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111007 Nonsense 116 585 2 8
Genomic Location (Zv9):
Chromosome 8 (position 55543703)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53504677
KASP Assay ID:
554-7680.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTACCACACGTTACCTCAGGCCCACATGGATGACCGTGTGATGTACT[G/A]GCCCCGCGGGCGTGTCTGGGGCGGCTCATCCTCACTTAACGCCATGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111007 Nonsense 209 585 2 8
Genomic Location (Zv9):
Chromosome 8 (position 55543981)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53504399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTATGCATTCATCCAGGCGGGACAGCAGGCTGGATACCCCTACACC[G/T]AGGACATGAACGGGTTCCAGCAGGAGGGGGTCGGCTGGATGGACATGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111007 Essential Splice Site 449 585 7 8
Genomic Location (Zv9):
Chromosome 8 (position 55550727)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53497653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGACCCCAGAGATCACCCCATCCTGCAGCCAAACTACCTGTCCACAG[G/A]TACACTCAGACTGCACTCCTGTCCAGTTATTTGTGGACTTCACTCGCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link