mfi2

Ensembl ID:
ENSDARG00000075159
ZFIN ID:
ZDB-GENE-050309-40
Human Orthologue:
MFI2
Human Description:
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 [Source:HGNC Sy
Mouse Orthologue:
Mfi2
Mouse Description:
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene [Source:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20718 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088403 Nonsense 209 723 5 16
Genomic Location:
Chromosome 6 (position 29808344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGACAATTTAAGTGTGATCCAAGCAACAAGGAGCTGTATTACGCATA[T/A]GATGGAGCATTCAGGTGTTGTATTCTTTGTTTTTTCATACAGAACTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bbgzg6wq