mfi2

Ensembl ID:
ENSDARG00000075159
ZFIN ID:
ZDB-GENE-050309-40
Human Orthologue:
MFI2
Human Description:
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 [Source:HGNC Sy
Mouse Orthologue:
Mfi2
Mouse Description:
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 Gene [Source:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20718 Nonsense Available for shipment Available now
sa31511 Nonsense Available for shipment Available now
sa31512 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088403 Nonsense 209 723 5 16
Genomic Location (Zv9):
Chromosome 6 (position 29808344)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30103987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGACAATTTAAGTGTGATCCAAGCAACAAGGAGCTGTATTACGCATA[T/A]GATGGAGCATTCAGGTGTTGTATTCTTTGTTTTTTCATACAGAACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088403 Nonsense 339 723 8 16
Genomic Location (Zv9):
Chromosome 6 (position 29811626)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30107269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCAAATTCATTCAAGCCGGAAATGAAAACTATAAGGAATGGATGGGA[C/T]GATACTATCACATACTGAAAGCTATGGACTGCTCACAGTCAGGTGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088403 Nonsense 444 723 11 16
Genomic Location (Zv9):
Chromosome 6 (position 29815440)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30111083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAAACCCCTGTGATTCTTTAGGAGACAGTGATGGAAGCATTTATTA[C/A]GCCGTGGCTGTGCTGAGAAAGAGCAACAGAGACATCCAGAGATTCAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link