igdcc3

Ensembl ID:
ENSDARG00000075158
ZFIN ID:
ZDB-GENE-080303-24
Description:
immunoglobulin superfamily, DCC subclass, member 3 [Source:RefSeq peptide;Acc:NP_001091714]
Human Orthologue:
IGDCC3
Human Description:
immunoglobulin superfamily, DCC subclass, member 3 [Source:HGNC Symbol;Acc:9700]
Mouse Orthologue:
Igdcc3
Mouse Description:
immunoglobulin superfamily, DCC subclass, member 3 Gene [Source:MGI Symbol;Acc:MGI:1202390]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34100 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34099 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111388 Essential Splice Site 315 773 6 14
Genomic Location (Zv9):
Chromosome 7 (position 32864673)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31259013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGAACACGAGTGCGCAGAACTGCTCAGGGACTCCTAGTTGTGCAAGG[T/C]GAGGCTTTTTGGGTACAAAACTATGAACTTAATATTTGTCTATTGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111388 Nonsense 636 773 12 14
Genomic Location (Zv9):
Chromosome 7 (position 32839201)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31233541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGCTCCACCACAGGCATCATCATCGGCATCCACATAGGAGTCACTTG[C/A]ATCATTTTCTGTGTCCTATTCCTCATGTTCAGCTACAGGGGCAGGTGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link