si:ch211-222g23.4

Ensembl ID:
ENSDARG00000075156
ZFIN ID:
ZDB-GENE-070912-210
Human Orthologue:
TBC1D4
Human Description:
TBC1 domain family, member 4 [Source:HGNC Symbol;Acc:19165]
Mouse Orthologue:
Tbc1d4
Mouse Description:
TBC1 domain family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2429660]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34676 Nonsense Available for shipment Available now
sa7334 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13545 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109137 Nonsense 227 1246 2 20
ENSDART00000143766 Nonsense 211 1230 2 20
ENSDART00000147813   None 202 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31633005)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30788951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATGGGCAGCGGAACTCCACTGAAGCCCCTGTGGAGTTTATTATGGGC[G/T]AGGATCCGTTAAGTTCATCCCTCTGTGAAGTGGATGAACCAGAATCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109137 Essential Splice Site 556 1246 9 20
ENSDART00000143766 Essential Splice Site 540 1230 9 20
ENSDART00000147813   None 202 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31644043)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30799989
KASP Assay ID:
554-4449.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGTGYATTGSTTTTGTTTTCACTAGTTMATTTCATTGTTTGTTCYCT[A/G]GGGGGCGAGCCGTATGCGAAWGCGCCTGGGCAGCATGGGTAGTTTTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109137 Nonsense 809 1246 13 20
ENSDART00000143766 Nonsense 793 1230 13 20
ENSDART00000147813   None 202 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31657350)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30813296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGCCATCCACCAACAAATTCTGCTCATCAGAATGGAGAAGGAGAAC[C/T]AGCRCCTGGAAGGTCAGTTATTCTCTTTTTTATTTATTTACATTTGTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link