LOC571003

Ensembl ID:
ENSDARG00000075154
Human Orthologue:
B3GALT1
Human Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 [Source:HGNC Symbol;Acc:916]
Mouse Orthologue:
B3galt1
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14483 Nonsense Available for shipment Available now
sa10759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113248 Nonsense 11 331 1 1
Genomic Location:
Chromosome 9 (position 50131046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACGTAAATGCCTCACAATGCCTTCAAAAGTGTCATGCCTCTACGTGT[T/A]GACGGTGGTTTGCTGGGCCAGCGCTCTGTGGTATCTAAGTATATCCCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113248 Nonsense 106 331 1 1
Genomic Location:
Chromosome 9 (position 50130761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAACAACGCACAAAGAGTTYGACGCCCGKCAGGCCATTCGAGAAAYAT[G/A]GGGCGACGAAAGCACATTTAGCGACCTGCGCATTATCACGCTGTTTCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p5ju3m41