OSBPL10 (1 of 2)

Ensembl ID:
ENSDARG00000075152
Description:
oxysterol binding protein-like 10 [Source:HGNC Symbol;Acc:16395]
Human Orthologue:
OSBPL10
Human Description:
oxysterol binding protein-like 10 [Source:HGNC Symbol;Acc:16395]
Mouse Orthologue:
Osbpl10
Mouse Description:
oxysterol binding protein-like 10 Gene [Source:MGI Symbol;Acc:MGI:1921736]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43194 Nonsense Mutation detected in F1 DNA During 2017
sa36746 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058552 Nonsense 152 648 5 12
Genomic Location (Zv9):
Chromosome 19 (position 1085569)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1381942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCCAGGCGGAAGGCCAGCAGAAGAGTCTGGTGCAGTCTATCGAGTG[T/A]CTGCCGACGCGAGGGTCCGTCTCCTGTCTGGATCAGGACCTGCTACTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058552 Nonsense 290 648 7 12
Genomic Location (Zv9):
Chromosome 19 (position 1092861)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1389234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGGAGTTCTGGAGGAGGAGCGGAGCGTCATTCTGCATCTGCTGTCT[C/T]AGCTCAAACTGGGCATGGACCTCACACGGGTGAGGATCACAACATAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Peripheral artery disease: Identification of evidence suggestive of an association with peripheral arterial disease at the OSBPL10 locus by genome-wide investigation in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link