ENSDARG00000075148

Ensembl ID:
ENSDARG00000075148

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30404 Nonsense Mutation detected in F1 DNA During 2016
sa24769 Nonsense Available for shipment Available now
sa30402 Nonsense Mutation detected in F1 DNA During 2016
sa44419 Nonsense Mutation detected in F1 DNA During 2016
sa44418 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112272 Nonsense 52 524 1 6
ENSDART00000123184   None 130 None 2
Genomic Location (Zv9):
Chromosome Zv9_NA681 (position 96436)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11467831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGTGAGGGAAGCTTTTGGATTAAATGGTAGATTCCGACTACAGTAT[C/T]AGGACAAAGATTTTGGAGATGTATTTGTAAATTTGACAAACACAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112272 Nonsense 141 524 2 6
ENSDART00000123184   None 130 None 2
Genomic Location (Zv9):
Chromosome Zv9_NA681 (position 94827)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11469464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAACAGTGGCCAAAAGAATTTAATATTCCACGCTTTTCTTATGACACT[G/T]AACTCCAATTAGAGAGAGGGAATGCTCTTTTTAAGACTAATGGAACAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112272 Nonsense 309 524 2 6
ENSDART00000123184   None 130 None 2
Genomic Location (Zv9):
Chromosome Zv9_NA681 (position 94322)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11469969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAACAATGCATTGACAATCAGAGAAAAAATGACAAAGACGTTCGCCT[T/A]ACGCAGACAAGAAATTGTGGAAAACAAACCTAGTGTTCAAGAACTGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112272 Nonsense 378 524 3 6
ENSDART00000123184   None 130 None 2
Genomic Location (Zv9):
Chromosome Zv9_NA681 (position 93697)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11470594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTCAGCTTCTCCAGGTTATTAGGAGCAAAGGTGGAATGTTCCGTGAC[A/T]AAACTAAGGACATTGTCAAAGTTATGGATCAGGTATTGGTTGCATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112272 Essential Splice Site 388 524 3 6
ENSDART00000123184   None 130 None 2
Genomic Location (Zv9):
Chromosome Zv9_NA681 (position 93664)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11470627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAATGTTCCGTGACAAAACTAAGGACATTGTCAAAGTTATGGATCAG[G/A]TATTGGTTGCATGCAAACACATTTTCTTATGGAAATCAATTAATAGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link