lrrc38

Ensembl ID:
ENSDARG00000075147
ZFIN ID:
ZDB-GENE-080327-12
Description:
cDNA, clone cssl:d0332 [Source:UniProtKB/TrEMBL;Acc:A8BB08]
Human Orthologue:
LRRC38
Human Description:
leucine rich repeat containing 38 [Source:HGNC Symbol;Acc:27005]
Mouse Orthologue:
Lrrc38
Mouse Description:
leucine rich repeat containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442845]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15979 Nonsense Available for shipment Available now
sa4230 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110041 Nonsense 43 290 1 2
Genomic Location:
Chromosome 23 (position 22091263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCATCCAGCTGCTTGTGTCCGGACCATCACACCGTGGACTGCACAGGT[C/T]AAGGGCTCACCCGTCTWCCAGACTCCATCCCTTTGGACGTGAGGAGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110041 Nonsense 285 290 2 2
Genomic Location:
Chromosome 23 (position 22069598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTYCCMCCATCCACTGTTTCCAGCGGCTCAAATCCAAAAGGACAGAT[G/T]AAGAGGAGGCAGAGGACTGAGGGCGGACACAATGGAAGTTACAAATTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u8sbclwn