LOC557486

Ensembl ID:
ENSDARG00000075139
Human Orthologue:
HDAC5
Human Description:
histone deacetylase 5 [Source:HGNC Symbol;Acc:14068]
Mouse Orthologue:
Hdac5
Mouse Description:
histone deacetylase 5 Gene [Source:MGI Symbol;Acc:MGI:1333784]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5196 Nonsense Mutation detected in F1 DNA During 2014
sa8948 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111435 Nonsense 166 1085 4 25
Genomic Location:
Chromosome 3 (position 23229782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGCCATCGCCAGTACTGAGGTCAAACTGAAGCTGCAGGAGTTTCTGT[T/A]GAGCAAAAAGGAGCCCGGCCCCGGTGGACTCAACCATTCCTTCCCCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111435 Nonsense 511 1085 11 25
Genomic Location:
Chromosome 3 (position 23246079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCCACGCCTCTRTTCAGATTCTTTCTAAAGGGACGGATCTTCCAAGA[C/T]AGCCTCCCACTCACCCAGAGGAGACGGARGAGGAACTTACGGAAACCGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vjiznaj4