LOC557486

Ensembl ID:
ENSDARG00000075139
Human Orthologue:
HDAC5
Human Description:
histone deacetylase 5 [Source:HGNC Symbol;Acc:14068]
Mouse Orthologue:
Hdac5
Mouse Description:
histone deacetylase 5 Gene [Source:MGI Symbol;Acc:MGI:1333784]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5196 Nonsense Mutation detected in F1 DNA During 2016
sa8948 Nonsense Mutation detected in F1 DNA During 2016
sa33155 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40058 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111435 Nonsense 166 1085 4 25
Genomic Location:
Chromosome 3 (position 23229782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGCCATCGCCAGTACTGAGGTCAAACTGAAGCTGCAGGAGTTTCTGT[T/A]GAGCAAAAAGGAGCCCGGCCCCGGTGGACTCAACCATTCCTTCCCCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111435 Nonsense 511 1085 11 25
Genomic Location:
Chromosome 3 (position 23246079)
KASP Assay ID:
2259-3367.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCCACGCCTCTRTTCAGATTCTTTCTAAAGGGACGGATCTTCCAAGA[C/T]AGCCTCCCACTCACCCAGAGGAGACGGARGAGGAACTTACGGAAACCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111435 Essential Splice Site 595 1085 12 25
Genomic Location:
Chromosome 3 (position 23253251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAAACTGAGCTGCGCTGAATAAAGGTTGTTTGTGTGTTGTTTCCCTC[A/T]GTATTTGGACCAGCAGCATGTGCAGCAGCTCAACGTGTTCCAGGCCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111435 Nonsense 848 1085 19 25
Genomic Location:
Chromosome 3 (position 23262492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTTATAGGATATCCATCATGGAAACGGGACCCAGCAGGCTTTCTA[T/A]AATGACCCCAATGTGTTATATATTTCTCTGCATCGTTATGACGATGGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link