BAI1 (2 of 3)

Ensembl ID:
ENSDARG00000075133
Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Human Orthologue:
BAI1
Human Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Mouse Orthologue:
Bai1
Mouse Description:
brain-specific angiogenesis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933736]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14551 Nonsense Available for shipment Available now
sa15683 Nonsense Available for shipment Available now
sa22905 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25026 Nonsense Mutation detected in F1 DNA During 2014
sa12101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 74 767 1 12
Genomic Location:
Chromosome 16 (position 38935212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGCATGCCCTGCACCTGGACCCTACAGAACCCTGATCCACGGCGCTA[C/A]ACCATCTTCATCAAAGTCACAAAACCAACTAGAGACTGCATTGCCCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 217 767 1 12
Genomic Location:
Chromosome 16 (position 38935639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAATGCTGGGACCAGCCTCCACTAGACAAAGAMTCCAATGGATGCTAT[C/T]GAGATGGGGTCTTTCTGGAAAACTGCAYCCCTGTTGTGAAAGAAGGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Essential Splice Site 240 767 1 12
Genomic Location:
Chromosome 16 (position 38935710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCATCCCTGTTGTGAAAGAAGGAGCGTCTGAAACTGACAATAGCGG[T/A]AAGACAGTTTTGTCTAGTTATAATTCAGCATGGTTTGATTGTTATTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 375 767 5 12
Genomic Location:
Chromosome 16 (position 38963289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGAGTGGTCTGCGTGGAGCGTGTGTTCGGCCACGTGTGGTGAGGGCT[G/A]GCAGAGCCGCACACGCTTCTGCGTCTCCGTGTCGTACAGCACGCAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112003 Nonsense 624 767 9 12
Genomic Location:
Chromosome 16 (position 38968433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTAATTCTACGGCGATGTTCATTAGACAATGAGGGTAKAGCATACTG[G/A]GAGARCCCAACATAWATGAAGTGCGTCTCAAATGATTACAGAAGTATCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r0ets6tu