hbegfa

Ensembl ID:
ENSDARG00000075121
ZFIN ID:
ZDB-GENE-080204-119
Description:
heparin-binding EGF-like growth factor [Source:RefSeq peptide;Acc:NP_001104696]
Human Orthologue:
HBEGF
Human Description:
heparin-binding EGF-like growth factor [Source:HGNC Symbol;Acc:3059]
Mouse Orthologue:
Hbegf
Mouse Description:
heparin-binding EGF-like growth factor Gene [Source:MGI Symbol;Acc:MGI:96070]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31972 Nonsense Mutation detected in F1 DNA During 2016
sa18135 Nonsense Available for shipment Available now
sa42344 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 64 230 2 6
Genomic Location (Zv9):
Chromosome 14 (position 7016163)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACCGTGGACAACAAGCTTGTGGAATATGAGGAGGAGGATGAAGAGTA[T/A]TACTATGATGATGATGTTGAAGAAGACGAGGAGGATGAGTTCTCTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 135 230 3 6
Genomic Location (Zv9):
Chromosome 14 (position 7016457)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAGGAAAGGGAAAAGGCAAGAAAAGAAACCCCTGTCTAAAAAAGTAC[A/T]AGGACTTTTGCATCCACGGAACCTGCCAGTACTTYAGGGATTTAAAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109138 Nonsense 195 230 4 6
Genomic Location (Zv9):
Chromosome 14 (position 7016726)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6743694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGACCGCACTACAGCCCTTGCTGTGGTAGCTGTGGTTCTCTCTTCAT[T/G]ATGTCTGACCATCATTGGCCTCCTCCTGGCACTCAGGTTTGTTTTTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link