si:ch211-57g18.1

Ensembl ID:
ENSDARG00000075120
ZFIN ID:
ZDB-GENE-030131-1426
Description:
Novel protein similar to human and mouse coiled-coil and C2 domain containing 1A (CC2D1A) [Source:Un
Human Orthologue:
CC2D1B
Human Description:
coiled-coil and C2 domain containing 1B [Source:HGNC Symbol;Acc:29386]
Mouse Orthologue:
Cc2d1b
Mouse Description:
coiled-coil and C2 domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:2443076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17351 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109504 Essential Splice Site 583 791 14 23
Genomic Location (Zv9):
Chromosome 2 (position 19187865)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19615455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATATTCCAAGCAGTTTACACACTTAGGGAATGTTGCAGAAACAACCAA[G/T]TATGTACCACACACAGTATAAACCACACTTTAATATTTAWTTTTTGATTK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link