LOC100333216

Ensembl ID:
ENSDARG00000075119
Human Orthologue:
NINL
Human Description:
ninein-like [Source:HGNC Symbol;Acc:29163]
Mouse Orthologue:
Ninl
Mouse Description:
ninein-like Gene [Source:MGI Symbol;Acc:MGI:1925427]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14908 Nonsense Available for shipment Available now
sa22217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111625 Nonsense 9 368 1 7
Genomic Location (Zv9):
Chromosome 13 (position 6999834)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6901479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCTGTGCAGTATGTGGTGGGATGGACGAGGATGAGCAGAACCGCTA[T/A]GTGGCCCAGCTGAAGGATGAATTTGACAGCTGTGACACYACTGGTACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111625 Nonsense 185 368 5 7
Genomic Location (Zv9):
Chromosome 13 (position 7020110)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6881203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTGCACAAATTCTGAATTATATACATTTAAGGCCAGCTGAAGCTCTG[G/A]AATCAAGATGGCACAGGAAATTGTCAACGCTCATCTGACAATCAGCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link