LOC100333216

Ensembl ID:
ENSDARG00000075119
Human Orthologue:
NINL
Human Description:
ninein-like [Source:HGNC Symbol;Acc:29163]
Mouse Orthologue:
Ninl
Mouse Description:
ninein-like Gene [Source:MGI Symbol;Acc:MGI:1925427]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14908 Nonsense Available for shipment Available now
sa22217 Nonsense Available for shipment Available now
sa19052 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3871 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111625 Nonsense 9 368 1 7
Genomic Location:
Chromosome 13 (position 6999834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCTGTGCAGTATGTGGTGGGATGGACGAGGATGAGCAGAACCGCTA[T/A]GTGGCCCAGCTGAAGGATGAATTTGACAGCTGTGACACYACTGGTACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111625 Nonsense 185 368 5 7
Genomic Location:
Chromosome 13 (position 7020110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTGCACAAATTCTGAATTATATACATTTAAGGCCAGCTGAAGCTCTG[G/A]AATCAAGATGGCACAGGAAATTGTCAACGCTCATCTGACAATCAGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111625 Essential Splice Site 243 368 5 7
ENSDART00000111625 Essential Splice Site 243 368 5 7
Genomic Location:
Chromosome 13 (position 7020286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCACTCGTCTGTGATCACATCGGACTTAAGCATTTAGAGGCTGAGG[T/C]ACTACTATCACCTAAATTATGGAGGATTCATAATCATCACATGCTGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111625 Essential Splice Site 243 368 5 7
ENSDART00000111625 Essential Splice Site 243 368 5 7
Genomic Location:
Chromosome 13 (position 7020286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTCACTCGTCTGTGATCACATCGGACTTAAGCATTTAGAGGCTGAGG[T/C]AYTACTATCACCTAAAYTATGGAGGATTCRTAATCATCACATGCTGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uj1juk03