mgam

Ensembl ID:
ENSDARG00000075118
Human Orthologues:
MGAM, RP11-1220K2.2, SI
Human Descriptions:
maltase-glucoamylase (alpha-glucosidase) [Source:HGNC Symbol;Acc:7043]
Putative maltase-glucoamylase-like protein FLJ16351 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZN80]
sucrase-isomaltase (alpha-glucosidase) [Source:HGNC Symbol;Acc:10856]
Mouse Orthologues:
Mgam, Sis
Mouse Descriptions:
maltase-glucoamylase Gene [Source:MGI Symbol;Acc:MGI:1203495]
sucrase isomaltase (alpha-glucosidase) Gene [Source:MGI Symbol;Acc:MGI:1917233]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13756 Essential Splice Site Available for shipment Available now
sa32180 Nonsense Mutation detected in F1 DNA During 2016
sa23206 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15292 Nonsense Available for shipment Available now
sa15546 Essential Splice Site Available for shipment Available now
sa28958 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32181 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36557 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11174 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Essential Splice Site 71 1809 3 52
Genomic Location (Zv9):
Chromosome 18 (position 2822402)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2212069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACAGACACCCAACATGCTTTTCTGAACATTCCTYGTGTCTCCTTACA[G/T]CAAAAATGTTTGGAAAGAGCCTGTTGCTGGAGCCCCCTGGATGAGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Nonsense 164 1809 5 52
Genomic Location (Zv9):
Chromosome 18 (position 2825241)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2214908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCACTGATGCAAAGCAAGCCAGGTTTGAAGTTCCTCATGAAAACGTG[A/T]AAGCCCCTGCCAACCCTCCCACCGGACCCTTAAAATACAAAGTAGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Essential Splice Site 255 1809 6 52
Genomic Location (Zv9):
Chromosome 18 (position 2828868)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2218535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACTGGAGGACCTGGCCTATCTTCACAAGAGACTCTTTCCCCAACGGC[G/A]TGAGTCTTAACATTTAGATCATGTATATCAGAGTATTCCAAACCAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Nonsense 427 1809 11 52
Genomic Location (Zv9):
Chromosome 18 (position 2841689)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2231356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTACAGGATCCTGCCGTATCCACAGGGCGCAGGWTAAACGGACCGTA[T/G]GACACAGTYGACAGGGGACATGCAGCTAAAGTTTGGGTCACTGAATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Essential Splice Site 615 1809 15 52
Genomic Location (Zv9):
Chromosome 18 (position 2847923)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2030679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGGCGATACCTGGCAWGCTGGAGTTTAACCTCTTTGGCATCCCTTAC[G/A]TAAGTGCTTTGACTTTNAATCCTTTACACTGCAYACGTAAAGAGACATTMG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Essential Splice Site 896 1809 26 52
Genomic Location (Zv9):
Chromosome 18 (position 2878014)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2060770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTAACCCTTTGCCTCAGTCACAGATTCAATACGACTCTGTCAAGCAGG[T/C]AAAAGCATTTATTCACCACTAAAGTCAAAAGTAATACTATGTGTCCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Essential Splice Site 1406 1809 41 52
Genomic Location (Zv9):
Chromosome 18 (position 2911155)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2093911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGAATACCAAACAGCCATGTAATAATATTGAATATATTGTCATTTTC[A/T]GCACTGGAGTCCAAGGAAAAAGGTCTGAACCATAAGACTTTATGCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Essential Splice Site 1452 1809 42 52
Genomic Location (Zv9):
Chromosome 18 (position 2911383)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2094139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTCTGGAATGGGTTGTAATTGCTGTGTTTGTTTACGTGTTCGTCAC[A/T]GTGCTTTGCATAGTACCACCGGAAAGAGAGGAGTTATAATTACCCGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110351 Nonsense 1577 1809 45 52
Genomic Location (Zv9):
Chromosome 18 (position 2924859)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2107615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTCGTGAYGTGCTGAATATCCGCTACMCCCTCYTGCCATACTTGTA[C/A]ACMCTGATGTRTGAAGCCMACACCAAGGGGACCACTGTGGTCAGACCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link