si:dkey-162b23.3

Ensembl ID:
ENSDARG00000075112
ZFIN ID:
ZDB-GENE-090312-106
Description:
Novel protein similar to vertebrate tachykinin receptor 3 (TACR3) [Source:UniProtKB/TrEMBL;Acc:B8JI0
Human Orthologue:
TACR3
Human Description:
tachykinin receptor 3 [Source:HGNC Symbol;Acc:11528]
Mouse Orthologue:
Tacr3
Mouse Description:
tachykinin receptor 3 Gene [Source:MGI Symbol;Acc:MGI:892968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10820 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114941 Nonsense 177 186 2 2
ENSDART00000145044 Nonsense 174 396 2 5
Genomic Location (Zv9):
Chromosome 1 (position 44226711)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43143027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAACCATCAAAAAACTGCCCAARCGAACTCTCTGCTATGTTGCCTG[G/A]CCGAGACCTTCAGAAGACCCTTTCATGTGAGTGCTATKTAAATATGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link