als2a

Ensembl ID:
ENSDARG00000075111
ZFIN ID:
ZDB-GENE-070402-2
Description:
Als2a protein [Source:UniProtKB/TrEMBL;Acc:A8KB94]
Mouse Orthologue:
Als2
Mouse Description:
amyotrophic lateral sclerosis 2 (juvenile) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1921268]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34579 Nonsense Mutation detected in F1 DNA During 2016
sa10766 Essential Splice Site Available for shipment Available now
hu3525 Nonsense Available for shipment Available now
sa41377 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17354 Nonsense Available for shipment Available now
sa34580 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108652 Nonsense 145 949 3 13
ENSDART00000108844   None 704 None 21
ENSDART00000128630 Nonsense 145 401 4 4
ENSDART00000135877   None 992 None 25
ENSDART00000143432   None 126 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13910912)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13663477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCAGTCCCACACCCGTTACTGTGGTGGATGACGAGACTCATCCTCCA[C/T]AACTGGTCCGAGTCCTAAATGTGGCTTGCGGAGCACAGCACACTCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108652 Essential Splice Site 723 949 8 13
ENSDART00000108844   None 704 None 21
ENSDART00000128630   None 401 None 4
ENSDART00000135877 Essential Splice Site 58 992 1 25
ENSDART00000143432   None 126 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13918073)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13670638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTYAGTAAACTGAAGAWCCAGATCCTGAGCCCTCTGTTAGCCCGTGG[T/A]ACGTAACACACTTCTTCACTCATCAGTGATCACACATTTTTGTTTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108652 Nonsense 838 949 11 13
ENSDART00000108844   None 704 None 21
ENSDART00000128630   None 401 None 4
ENSDART00000135877 Nonsense 173 992 4 25
ENSDART00000143432   None 126 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13922932)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13675497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGAATCCAAGGAGAAGAACCCGTCGCTCTATGATCTGTTAGTAAACT[T/A]GTTTTACATGCCCTTGCAACACTTGAATGGGTATAACAGGTTACTTCTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108652   None 949 None 13
ENSDART00000108844 Essential Splice Site 164 704 5 21
ENSDART00000128630   None 401 None 4
ENSDART00000135877 Essential Splice Site 452 992 11 25
ENSDART00000143432   None 126 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13933581)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13686146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCAAGGTCACTGGAAGGAAGGAAAAATGCATGGCTTTGGCACTTTCTG[G/A]TAATAATAATGAAAATTTGTATGAAAAATTCCAATGTCTAACTAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108652   None 949 None 13
ENSDART00000108844 Nonsense 598 704 18 21
ENSDART00000128630   None 401 None 4
ENSDART00000135877 Nonsense 886 992 22 25
ENSDART00000143432   None 126 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13945499)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13698064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATCATTTKGGTTTAATGGACAGGTTCTGCCTAGTACTAAAGACGCCTG[C/A]TTTTCCACTGCTGTTGAAACCCTGCAACAGATCAGGTAAAGAYAGCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108652   None 949 None 13
ENSDART00000108844 Essential Splice Site 610 704 18 21
ENSDART00000128630   None 401 None 4
ENSDART00000135877 Essential Splice Site 898 992 22 25
ENSDART00000143432   None 126 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13945536)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13698101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGACGCCTGCTTTTCCACTGCTGTTGAAACCCTGCAACAGATCAGG[T/G]AAAGACAGCTTGGTGCAACAAAATTAGAAAAACCACAGCAACACTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link