dab2ip

Ensembl ID:
ENSDARG00000075110
ZFIN ID:
ZDB-GENE-030131-2449
Description:
DAB2 interacting protein [Source:RefSeq peptide;Acc:NP_001116329]
Human Orthologue:
DAB2IP
Human Description:
DAB2 interacting protein [Source:HGNC Symbol;Acc:17294]
Mouse Orthologue:
Dab2ip
Mouse Description:
disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI Symbol;Acc:MGI:1916851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40483 Nonsense Mutation detected in F1 DNA During 2017
sa38484 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110645 Nonsense 556 1061 8 13
ENSDART00000133504 Nonsense 604 1109 9 14
Genomic Location (Zv9):
Chromosome 5 (position 35312022)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 33093971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGAGCGTTCCTTCTGACCGAGTGCCCTCGCCACCAGTCCCTGGATG[C/A]AGCATCTCCACTGGAATACAAAAGATGGCCATTGACAGCGACCTGCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110645 Essential Splice Site 1006 1061 12 13
ENSDART00000133504 Essential Splice Site 1054 1109 13 14
Genomic Location (Zv9):
Chromosome 5 (position 35300741)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 33082690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATATGCAGGCAGTTGTTGACTCCAAACAGAAGATCATTGATGCACAG[G/A]TACTGTATGTCTATAACAGCAGTCATGGAATCCAAACTATTTTGGGATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link