TMCO3

Ensembl ID:
ENSDARG00000075108
Description:
transmembrane and coiled-coil domains 3 [Source:HGNC Symbol;Acc:20329]
Human Orthologue:
TMCO3
Human Description:
transmembrane and coiled-coil domains 3 [Source:HGNC Symbol;Acc:20329]
Mouse Orthologue:
Tmco3
Mouse Description:
transmembrane and coiled-coil domains 3 Gene [Source:MGI Symbol;Acc:MGI:2444946]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9562 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109529 Nonsense 488 629 11 14
Genomic Location:
Chromosome 1 (position 97435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGTCGATGGAGCTGGGTTGTTTTCTGGCCGGAGCGCTGCTGTCCTCT[C/T]AGGGTCACATGGTCACGGCAGAGGTCATGACCTGCGCTGAACCCATCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eto13ofv