LOC792970

Ensembl ID:
ENSDARG00000075089
Human Orthologue:
CD97
Human Description:
CD97 molecule [Source:HGNC Symbol;Acc:1711]
Mouse Orthologue:
Cd97
Mouse Description:
CD97 antigen Gene [Source:MGI Symbol;Acc:MGI:1347095]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32805 Nonsense Mutation detected in F1 DNA During 2016
sa25710 Nonsense Mutation detected in F1 DNA During 2016
sa5944 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110808 Nonsense 410 730 11 17
Genomic Location:
Chromosome 1 (position 59220369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTGAGTCTGAGAGGGGGTGGTCTGGGCGGGGCTGTGAGTTGGCGT[G/A]GTCTAACAGCACTCATACAGCATGTTCCTGCTCTCACCTGAGCAGTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110808 Nonsense 629 730 15 17
Genomic Location:
Chromosome 1 (position 59224267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTATCAGCAGTTTTGATGAACTCTGTTGTGTTTTCAGGAGTTTTT[T/A]GGCGACCGCAGTGGCTCAGCTGTGTGTTCTTGGAGGATCTTGGGTTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110808 Nonsense 720 730 17 17
Genomic Location:
Chromosome 1 (position 59225951)
KASP Assay ID:
554-3750.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAATCAGTTTGTGGTTTAAGTTYATTCATTACATTACAGAAGCCTCTA[C/T]AAATCGACCAGAGCACAGGAGAGTCGACAATCTGAAGCTGTGAGCGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link