RPAP1

Ensembl ID:
ENSDARG00000075072
Description:
RNA polymerase II associated protein 1 [Source:HGNC Symbol;Acc:24567]
Human Orthologue:
RPAP1
Human Description:
RNA polymerase II associated protein 1 [Source:HGNC Symbol;Acc:24567]
Mouse Orthologue:
Rpap1
Mouse Description:
RNA polymerase II associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1916175]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17417 Essential Splice Site Available for shipment Available now
sa39167 Nonsense Mutation detected in F1 DNA During 2016
sa6486 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110167 Essential Splice Site 335 1406 7 25
Genomic Location (Zv9):
Chromosome 17 (position 31632768)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31556695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGAATATGRGGATGGTCAGCTTCTAGTTCAATCTCCAATTTCAGG[T/A]AAGYGATTTCAGTGCCACTACATGGAAATGAAGTTTGAATACAATTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110167 Nonsense 343 1406 8 25
Genomic Location (Zv9):
Chromosome 17 (position 31629400)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31553327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGTGTTTATTTATTTATTTACAGAAGAGGAGCTGCCCATCAGGCCA[C/T]AGAAGGAGTGGGTTCACATGGACAAAGTGGAGCCAGAAAAACTGGAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110167 Nonsense 603 1406 14 25
Genomic Location (Zv9):
Chromosome 17 (position 31620939)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31544866
KASP Assay ID:
554-4132.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTWAGCTGTTTTTTTTWATTATAATSCACCCTTTCTTTGGTCAGATCT[T/A]GGACTGCCCGCGGCTGATGGACRCTGTGATTTCGGAGTTTCTCCCCTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link