AIPL1

Ensembl ID:
ENSDARG00000075067
Description:
aryl hydrocarbon receptor interacting protein-like 1 [Source:HGNC Symbol;Acc:359]
Human Orthologue:
AIPL1
Human Description:
aryl hydrocarbon receptor interacting protein-like 1 [Source:HGNC Symbol;Acc:359]
Mouse Orthologue:
Aipl1
Mouse Description:
aryl hydrocarbon receptor-interacting protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2148800]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7760 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113199 Nonsense 89 462 2 6
Genomic Location:
Chromosome 15 (position 24234864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACGCTGCTCATGTCAATGCATATCGGAGAGGTGGCTGAGTTCTGGTG[T/A]GATGTCATCGTAAGTACACCATCCTCCATGATGTCCTGGWGAGGGTAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ju53au67